FASTQ - Text data format

FASTQ is a text data format created in 2000.

#369on PLDB

24Years Old

FASTQ format is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are each encoded with a single ASCII character for brevity. It was originally developed at the Wellcome Trust Sanger Institute to bundle a FASTA formatted sequence and its quality data, but has recently become the de facto standard for storing the output of high-throughput sequencing instruments such as the Illumina Genome Analyzer.. Read more on Wikipedia...

FASTQ Wikipedia page
FASTQ first developed in Wellcome Trust Sanger Institute
See also: (2 related languages)ASCII, FASTA

Example from the web:

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

Example from Wikipedia:

sed -e 'n;n;n;y/!"#$%&'\''()*+,-.\/0123456789:;<=>?@ABCDEFGHIJKL/▁▁▁▁▁▁▁▁▂▂▂▂▂▃▃▃▃▃▄▄▄▄▄▅▅▅▅▅▆▆▆▆▆▇▇▇▇▇██████/' myfile.fastq   # add -i to save the result to the same input file